SoyBase Follow us on Twitter @SoyBaseDatabase
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma02g15600

Feature Type:gene_model
Chromosome:Gm02
Start:14104536
stop:14108511
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma02g15600
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G43710AT Annotation by Michelle Graham. TAIR10: Plant stearoyl-acyl-carrier-protein desaturase family protein | chr2:18120107-18122495 FORWARD LENGTH=401 SoyBaseE_val: 0ISS
GO:0000096GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur amino acid metabolic process SoyBaseN/AISS
GO:0002213GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to insect SoyBaseN/AISS
GO:0006546GO-bp Annotation by Michelle Graham. GO Biological Process: glycine catabolic process SoyBaseN/AISS
GO:0006631GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid metabolic process SoyBaseN/AISS
GO:0006633GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid biosynthetic process SoyBaseN/AISS
GO:0006636GO-bp Annotation by Michelle Graham. GO Biological Process: unsaturated fatty acid biosynthetic process SoyBaseN/AISS
GO:0006655GO-bp Annotation by Michelle Graham. GO Biological Process: phosphatidylglycerol biosynthetic process SoyBaseN/AISS
GO:0006733GO-bp Annotation by Michelle Graham. GO Biological Process: oxidoreduction coenzyme metabolic process SoyBaseN/AISS
GO:0006766GO-bp Annotation by Michelle Graham. GO Biological Process: vitamin metabolic process SoyBaseN/AISS
GO:0006816GO-bp Annotation by Michelle Graham. GO Biological Process: calcium ion transport SoyBaseN/AISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0008610GO-bp Annotation by Michelle Graham. GO Biological Process: lipid biosynthetic process SoyBaseN/AISS
GO:0008652GO-bp Annotation by Michelle Graham. GO Biological Process: cellular amino acid biosynthetic process SoyBaseN/AISS
GO:0009072GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family metabolic process SoyBaseN/AISS
GO:0009106GO-bp Annotation by Michelle Graham. GO Biological Process: lipoate metabolic process SoyBaseN/AISS
GO:0009108GO-bp Annotation by Michelle Graham. GO Biological Process: coenzyme biosynthetic process SoyBaseN/AISS
GO:0009117GO-bp Annotation by Michelle Graham. GO Biological Process: nucleotide metabolic process SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0015995GO-bp Annotation by Michelle Graham. GO Biological Process: chlorophyll biosynthetic process SoyBaseN/AISS
GO:0016117GO-bp Annotation by Michelle Graham. GO Biological Process: carotenoid biosynthetic process SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019748GO-bp Annotation by Michelle Graham. GO Biological Process: secondary metabolic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0044272GO-bp Annotation by Michelle Graham. GO Biological Process: sulfur compound biosynthetic process SoyBaseN/AISS
GO:0051607GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to virus SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:2000022GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:2000031GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0004768GO-mf Annotation by Michelle Graham. GO Molecular Function: stearoyl-CoA 9-desaturase activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0045300GO-mf Annotation by Michelle Graham. GO Molecular Function: acyl-[acyl-carrier-protein] desaturase activity SoyBaseN/AISS
GO:0046914GO-mf Annotation by Michelle Graham. GO Molecular Function: transition metal ion binding SoyBaseN/AISS
PF03405PFAM Fatty acid desaturase JGI ISS
UniRef100_B8XJY3UniRef Annotation by Michelle Graham. Most informative UniRef hit: Acyl-[acyl-carrier-protein] desaturase n=1 Tax=Glycine max RepID=B8XJY3_SOYBN SoyBaseE_val: 0ISS
UniRef100_B8XJY3UniRef Annotation by Michelle Graham. Best UniRef hit: Acyl-[acyl-carrier-protein] desaturase n=1 Tax=Glycine max RepID=B8XJY3_SOYBN SoyBaseE_val: 0ISS

Proteins Associated with Glyma02g15600
LocusGene SymbolProtein Name
FAB2
SACPD-B stearoyl-acyl carrier protein desaturase

Expression Patterns of Glyma02g15600
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma02g15600
ParalogEvidenceComments
Glyma07g32850 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma02g15600 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.02g138100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma02g15600
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma02g15600
>Glyma02g15600.1   sequence type=CDS   gene model=Glyma02g15600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCTGAGACTGAACCCTATCCCCACCCAAACCTTCTCCCTCCCCCAAATGGCCAGTCTCAGATCTCCCAGGTTCCGCATGGCCTCCACCCTCCGCTCCGGTTCCAAAGAGGTTGAAAATATTAAGAAGCCATTCACTCCTCCCAGAGAAGTGCATGTTCAAGTAACCCACTCTATGCCTCCTCAGAAGATTGAGATTTTCAAATCTTTGGAGGATTGGGCTGAGCAGAACATCTTGACTCATCTTAAACCTGTTGAAAAATGTTGGCAACCACAAGATTTTTTACCGGATCCTTCCTCTGATGGATTTGAAGAGCAAGTGAAGGAACTGAGAGAGAGGGCAAAGGAGCTTCCAGATGATTACTTTGTTGTTCTGGTCGGAGACATGATCACAGAGGAAGCCCTGCCTACTTACCAAACAATGTTAAATACTTTGGATGGAGTTCGTGATGAAACAGGTGCCAGCCTTACTTCCTGGGCAATTTGGACAAGGGCATGGACTGCTGAAGAAAACAGACACGGTGATCTTCTTAACAAATATCTTTACTTGAGTGGTCGAGTTGACATGAAACAAATTGAAAAGACAATTCAGTACCTTATTGGGTCTGGAATGGATCCTCGAACCGAGAACAGCCCCTACCTTGGTTTCATTTACACTTCATTTCAAGAGAGGGCAACCTTCATATCCCACGGAAACACAGCCAGGCTTGCTAAGGAGCACGGCGATATAAAGTTGGCCCAGATCTGCGGCATGATTGCCTCAGATGAGAAACGCCATGAGACTGCATACACGAAGATAGTGGAAAAGCTATTTGAGGTCGATCCTGACGGTACAGTTATGGCGTTTGCCGACATGATGAGGAAGAAGATTGCCATGCCAGCACACCTCATGTATGACGGCCGTGATGACAACCTGTTTGATAGCTACTCTTCGGTCGCGCAGCGCATTGGGGTCTACACCGCCAAGGACTATGCTGACATACTTGAGTTTCTGGTGGGGAGGTGGAAGGTGGAGCAGCTAACTGGACTTTCAGGCGAGGGAAGAAAGGCTCAAGAATACATTTGCGGGCTGCCGCCAAGAATCAGAAGGTTGGAGGAGAGAGCTCAAGCAAGAGTCAAGGAGTCGTCAACACTTAAATTCAGTTGGATTCATGACAGGGAAGTACTACTCTAA
Predicted protein sequences of Glyma02g15600
>Glyma02g15600.1   sequence type=predicted peptide   gene model=Glyma02g15600   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALRLNPIPTQTFSLPQMASLRSPRFRMASTLRSGSKEVENIKKPFTPPREVHVQVTHSMPPQKIEIFKSLEDWAEQNILTHLKPVEKCWQPQDFLPDPSSDGFEEQVKELRERAKELPDDYFVVLVGDMITEEALPTYQTMLNTLDGVRDETGASLTSWAIWTRAWTAEENRHGDLLNKYLYLSGRVDMKQIEKTIQYLIGSGMDPRTENSPYLGFIYTSFQERATFISHGNTARLAKEHGDIKLAQICGMIASDEKRHETAYTKIVEKLFEVDPDGTVMAFADMMRKKIAMPAHLMYDGRDDNLFDSYSSVAQRIGVYTAKDYADILEFLVGRWKVEQLTGLSGEGRKAQEYICGLPPRIRRLEERAQARVKESSTLKFSWIHDREVLL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo